Induction of apoptosis by ATF6 1 Activating Transcription Factor-6 (ATF6) Mediates Apoptosis with Reduction of Myeloid Cell Leukemia Sequence 1 (Mcl-1) via Induction of WW Domain Binding Protein 1*

Endoplasmic reticulum (ER) stress is involved in both physiological and pathological apoptosis. ER stress triggers the unfolded protein response (UPR), which can then initiate apoptosis, when the cell fails to restore ER homeostasis. However, the mechanism employed by the UPR to lead cells into apoptosis is unknown. Among the three proximal sensors of ER stress, activating transcription factor-6 (ATF6) is specifically activated in apoptotic myoblasts during myoblast differentiation. This implies that active ATF6 has the ability to mediate apoptosis. Here, we demonstrate that over-expression of active ATF6 induced apoptosis in myoblast cells. Moreover, co-expression of a dominant negative form of ATF6 suppressed apoptosis. This suggested that apoptosis-related pathways depended on ATF6-mediated transcription activation. ATF6 caused up-regulation of the WW domain binding protein 1 (WBP1), probably via an indirect mechanism. Furthermore, WBP1 was also found to be pro-apoptotic. The silencing of WBP1 with small hairpin RNAs caused partial, but significant suppression of ATF6-induced apoptosis. Over-expression of active ATF6 or WBP1 caused a specific reduction in an anti-apoptotic protein, myeloid cell leukemia sequence 1 (Mcl-1). This suggested a molecular link between the UPR and an apoptosis regulator. Neither Bcl-2 nor Bcl-xL were reduced upon apoptosis induction in C2C12 cells that over-expressed ATF6 or WBP1. Cells treated with ER stressors underwent apoptosis concomitant with an up-regulation of WBP1 and suppression of Mcl-1. These results suggested that Mcl-1 is a determinant of cell fate, and ATF6 mediates apoptosis via specific suppression of Mcl-1 through up-regulation of WBP1. Endoplasmic reticulum (ER) stress occurs when ER homeostasis is lost due to an overload of protein folding in the ER (1). ER stress triggers an evolutionarily conserved response termed the unfolded protein response (UPR) (2). The UPR alters transcriptional and translational programs to cope with the accumulation of unfolded or misfolded proteins. Failure to resolve a protein-folding defect and restore ER homeostasis induces the UPR to initiate apoptosis. This protects the organism by http://www.jbc.org/cgi/doi/10.1074/jbc.M111.233502 The latest version is at JBC Papers in Press. Published on August 13, 2011 as Manuscript M111.233502 Copyright 2011 by The American Society for Biochemistry and Molecular Biology, Inc. by gest on Jauary 1, 2018 hp://w w w .jb.org/ D ow nladed from Induction of apoptosis by ATF6 2 removing the stressed cell (2, 3). ER stress-induced apoptosis is involved in many diseases (1), but it is also observed during normal development (4). The UPR is mediated by three ER-resident transmembrane proteins that sense ER stress and signal downstream pathways. These proximal sensors include the kinase and ribonuclease IRE1, the eIF2α kinase PERK, and activating transcription factor-6 (ATF6) (5). ER stress induces the autophosphorylation and activation of IRE1 and PERK, which results in the activation of downstream transcription factors. In addition, ER stress leads to ATF6 transit through the Golgi complex, where it is sequentially cleaved for activation by the proteases S1P and S2P (6). The cleaved N-terminal ATF6 cytoplasmic domain is released from the Golgi membrane, and it translocates to the nucleus to regulate transcription. These three sensor proteins comprise parallel pathways connected by signaling crosstalk through gene expression (7). Several mechanisms have been proposed that link the distressed ER to apoptosis, including the activation of transcription factors and expression of Bcl-2 family proteins. However, the mechanism triggered by the UPR that eventually leads to apoptosis after prolonged ER stress is unknown (8). For example, in some experimental settings, over-expression of a protein homologous to the CCAAT-enhancer-binding protein (CHOP, also known as GADD153) may be involved. CHOP is an ER stress-inducible member of the C/EBP family of bZIP transcription factors that induces apoptosis through a Bcl-2 inhibitable mechanism (9, 10). However, CHOP-/cells are only partially resistant to ER stress-induced apoptosis. This observation suggested that a CHOP-independent mechanism can also induce apoptosis in response to ER stress. In a previous study, a genome-wide screen of an RNAi library did not identify any genes associated with ER-stress-induced apoptosis in HeLa cell derivatives (11). This may reflect multiplicity in apoptotic signal transduction during ER stress-induced apoptosis. Multiplicity may occur because ER stressors used in typical experiments activate all three arms of the UPR. We previously showed that ER stress signaling was involved in the induction of developmental apoptosis in muscle tissues through the activation of caspase-12 (4). Myoblast cells exhibit considerable morphological changes during myogenesis, and they fuse into multinucleated myotubes. Myoblast fusion is associated with apoptosis in a subpopulation of cells (12), a phenomenon that has long been considered an example of cell degeneration during normal vertebrate ontogeny (13). Our previous study suggested that, during myogenesis, ER stress signaling is mediated mainly by ATF6. When C2C12 mouse myoblast cells were cultured under differentiation conditions, we observed specific activation of the ATF6 pathway in dying cells, but not the IRE1 or PERK pathways (4). When a specific inhibitor of S1P was added, these cells were resistant to apoptosis; moreover, concomitant with the reduction in cell death, we found no detectable activation of ATF6 (4). These results prompted us to explore the possibility that active ATF6 has the ability to mediate apoptosis on its own. In the present study, we examined the effect of forced expression of active ATF6 in C2C12 cells without simultaneously activating all three proximal arms of the UPR. Experimental Procedures Plasmid DNAsFANTOM3 cDNA clones of ATF6, WBP1, CDKap2, Creld2, Sel1, Tmem50b, PDCD4, and ARMET were obtained from the Genome Exploration Research Group, Genomic Sciences Center of RIKEN (14). The names of these genes are listed in supplemental Table 1. CHOP, myeloid cell leukemia sequence (Mcl)-1, and Aloxe3 cDNAs were amplified by PCR from mouse pancreas cDNA pools (Zyagen). Human ATF6 cDNA was kindly provided by R. Prywes (Biological Sciences, Columbia University). cDNAs were cloned into a variety of vectors, including pcDNA3.1(-) (Invitrogen), pEGFPC1, pEGFPN3, and pDsRed-Monomer-C1 (Clontech). Cell CultureC2C12 cells (RIKEN Cell Bank, Tsukuba, Japan) were grown in DMEM medium (Invitrogen) with 20% fetal bovine serum (FBS; Invitrogen) at 37 ̊C and 5% CO2, as described previously (4). NIH-3T3 and COS-1 by gest on Jauary 1, 2018 hp://w w w .jb.org/ D ow nladed from Induction of apoptosis by ATF6 3 cells were grown in DMEM medium with 10% FBS. mIMCD-3 cells (American Type Culture Collection) were grown in DMEM:F12 medium (Invitrogen) with 10% FBS. MCF-7 cells (Cell Resource Center for Biomedical Research, Tohoku University) were cultured in RPMI1640 medium (Invitrogen) with 10% FBS. Cell treatment with ER stressors was performed as described previously (15). Cell transfection was performed with Superfect Transfection Reagent (Qiagen) (16). C2C12 cells (5×10 cells/ml) were electroporated with 10 μg of DNA with a Microporator MP-100 (Invitrogen) and 100 μl microporation tips, according to the manufacturer’s protocol. Six to eight hours after electroporation, dead cells (floating cells) were removed by suction, and electroporated cells were incubated in fresh medium. Apoptosis Assay by TransfectionAt 24 h posttransfection, cells were observed under a fluorescence microscope (16). Over 200 GFP positive cells were randomly selected from each transfection experiment, and dead cells were identified by their morphology (small, round cells). Dead cells also showed nuclear condensation, a hallmark of apoptosis, detected by staining with 1 μg/ml Hoechst dye 33342 (Fig. 1B). Some dead cells underwent membrane blebbing (Fig. 1C). Statistical AnalysisData are presented as the mean ± SD. All bar graphs represent n = 3 for each experimental group. Significant differences among groups were determined by analysis of variance followed by the Student's t-test. Microarray AnalysisTwenty-four hours after electroporation, total RNA was isolated with an RNeasy Mini Kit (Qiagen). Firstand second-strand cDNAs were synthesized from 1 μg of total RNA with the One-Cycle cDNA Synthesis Kit (Affymetrix) according to the manufacturer's instructions. cRNA was synthesized and labeled with biotinylated UTP by in vitro transcription (IVT) with the IVT Labeling Kit (Affymetrix) and the T7 promoter-coupled double-stranded cDNA as template. The labeled cRNA was separated from unincorporated ribonucleotides by filtering through an IVT cRNA Cleanup Spin Column (Affymetrix). Biotin-labeled cRNAs were hybridized to GeneChip Mouse Genome 430a 2.0 Array chips (Affymetrix) and analyzed with the GeneChip Scanner 3000 7G (Affymetrix). Raw expression data were generated with GeneSpring software (Silicon Genetics). Real-time Quantitative PCR AnalysiscDNA was synthesized from 1 μg of total RNA with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR was performed on an Applied Biosystems 7900HT with TaqMan probes (Applied Biosystems). Relative gene expression levels were calculated with standard curves generated by serial dilution of cDNA isolated from C2C12 cells. Each cDNA sample was diluted with EASY Dilution (Takara Bio) and analyzed in triplicate. To determine relative gene expression, the expression of GAPDH was used as an internal standard. The expression of each gene was assessed by three independent PCR analyses. Prediction of Transmembrane Regions and OrientationcDNA sequences were analyzed by TMpred software (available at http://www.ch.embnet.org/software/TMPRED_f orm.html). Western Blot AnalysisCells were lysed in RIPA buffer that contained COMPLETE protease inhibitor cocktail (Roche). Protein concentration was quantified with a protein assay (Bio-Rad), and BSA was used as a standard. Western blot analysis was performed as described previously (4). For several experiments, dead cells were separated from live cells for sample preparation (16). Dead cells (floating) were isolated from the culture medium after centrifugation at 1,000 × g for 10 min. After several washes, live cells were scraped from culture dishes. MicroscopyImages were captured with an ORCA-ER cooled charge-coupled camera (Hamamatsu Photonics) mounted on an IX70 microscope (Olympus Optical Co.). All images were captured at either 20-fold or 40-fold magnification with Plan-SemiApochromat objective lenses (20×, 0.40 NA; 40×, 0.60 NA). Images were acquired and processed with IPLab software (Scanalytics, Inc.). ImmunocytochemistryC2C12 cells were grown in four-chamber slides (Nalge-Nunc), then fixed in 4% paraformaldehyde/PBS, and permeabilized in 0.1% Triton X-100 (4). Fixed, by gest on Jauary 1, 2018 hp://w w w .jb.org/ D ow nladed from Induction of apoptosis by ATF6 4 permeabilized cells were blocked in PBS that contained 3% BSA (Jackson Immuno Research Laboratories) and incubated overnight at 4 ̊C with anti-Sar1 antibody in blocking solution. Immunoreactivity was detected with a biotin-conjugated secondary antibody (Jackson Immuno Research) and Alexa594-streptavidin (Molecular Probes). Immunostained images were captured with an FV1000D confocal microscope (Olympus). All images were captured at 60-fold magnification with a PLAPON 60× oil objective lens (1.42 NA). Images were acquired and processed with FV10-ASW software (Olympus). Selected images were pseudo-colored for presentation in ImageJ. AntibodiesThe primary antibodies for immunostaining were: anti-Mcl-1 (Epitomics), anti-Bcl-xL (Sigma-Aldrich), anti-Bcl-2 (MBL), anti-caspase-12 (17), anti-active caspase-9 and anti-caspase-3 (Cell Signaling), anti-CHOP and anti-α-tubulin (Santa Cruz), anti-GAPDH (Chemicon), anti-GFP (Molecular Probes), anti-BiP (Transduction Laboratories), anti-WBP1 (ProteinTech), and anti-Sar1 (Abcam). shRNA PlasmidThe following pairs of synthetic DNAs were annealed and cloned into the pGeneClip hMGFP vector (Promega) according to the manufacturer’s protocol. The MGFP coding region was deleted to make a shRNA plasmid for co-transfection with GFP-ATF6 (1-360). WBP1 version A: Sense-TCTCGGACTGTCCTCATCCTCTTTA CTTCCTGTCATAAAGAGGATGAGGACAG TCCCT Antisense-CTGCAGGGACTGTCCTCATCCT CTTTATGACAGGAAGTAAAGAGGATGAG GACAGTCC WBP1 version C: Sense -TCTCGGCTAAACTCAGGCTGCAAC ACTTCCTGTCATGTTGCAGCCTGAGTTTA GCCCT Antisense-CTGCAGGGCTAAACTCAGGCTG CAACATGACAGGAAGTGTTGCAGCCTGA GTTTAGCC Mcl-1 version A: Sense -TCTCGCGTAAACCAAGAAAGCTTC ACTTCCTGTCATGAAGCTTTCTTGGTTTA CGCCT Antisense-CTGCAGGCGTAAACCAAGAAA GCTTCATGACAGGAAGTGAAGCTTTCTT GGTTTACGC Mcl-1 version B: Sense -TCTCGCTGGTCTGGCATATCTAAT ACTTCCTGTCATATTAGATATGCCAGACC AGCCT Antisense-CTGCAGGCTGGTCTGGCATATC TAATATGACAGGAAGTATTAGATATGCC AGACCAGC Mcl-1 version C: Sense -TCTCGGACTGGCTTGTCAAACAAA GC TTCCTGTCACTTTGTTTGACAAGCCAGTC CCT Antisense-CTGCAGGGACTGGCTTGTCAAA CAAAGTGACAGGAAGCTTTGTTTGACAA GCCAGTCC